Transcript: Human XM_017000082.1

PREDICTED: Homo sapiens semaphorin 6C (SEMA6C), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEMA6C (10500)
Length:
2765
CDS:
244..2337

Additional Resources:

NCBI RefSeq record:
XM_017000082.1
NBCI Gene record:
SEMA6C (10500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005663 CCGAGTATGTAAACGTGACAT pLKO.1 225 5UTR 100% 4.950 6.930 N SEMA6C n/a
2 TRCN0000005664 GCTGTAGTTTACAGAAGCCTT pLKO.1 66 5UTR 100% 2.640 2.112 N SEMA6C n/a
3 TRCN0000423159 CTTCACCACCCAGACCAATAG pLKO_005 402 CDS 100% 10.800 7.560 N SEMA6C n/a
4 TRCN0000412722 TCCTCAGTGAGCCAGCATTTC pLKO_005 2550 3UTR 100% 10.800 7.560 N SEMA6C n/a
5 TRCN0000005662 CGCCTCGGGTTTATTTATTGA pLKO.1 2479 3UTR 100% 5.625 3.938 N SEMA6C n/a
6 TRCN0000005666 GTGGAACCAGAACAGGAACAA pLKO.1 1704 CDS 100% 4.950 3.465 N SEMA6C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.