Transcript: Human XM_017000084.1

PREDICTED: Homo sapiens influenza virus NS1A binding protein (IVNS1ABP), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IVNS1ABP (10625)
Length:
8338
CDS:
1375..2670

Additional Resources:

NCBI RefSeq record:
XM_017000084.1
NBCI Gene record:
IVNS1ABP (10625)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274280 ATGGAATTTCTCACGTTAAAT pLKO_005 782 5UTR 100% 15.000 21.000 N IVNS1ABP n/a
2 TRCN0000021117 GCCCAGCAATGGCAAATTATA pLKO.1 1143 5UTR 100% 15.000 21.000 N IVNS1ABP n/a
3 TRCN0000021115 GCCCGATTTCAAATGGCTGTA pLKO.1 1957 CDS 100% 4.050 5.670 N IVNS1ABP n/a
4 TRCN0000285183 GCCCGATTTCAAATGGCTGTA pLKO_005 1957 CDS 100% 4.050 5.670 N IVNS1ABP n/a
5 TRCN0000021114 CCTCTCAAACTAACAGGCTTA pLKO.1 2683 3UTR 100% 4.050 3.240 N IVNS1ABP n/a
6 TRCN0000274341 CTGCATCTCTTACCGAAATTT pLKO_005 978 5UTR 100% 15.000 10.500 N IVNS1ABP n/a
7 TRCN0000021116 GCAGTCCCTATTTATTTGAAA pLKO.1 737 5UTR 100% 5.625 3.938 N IVNS1ABP n/a
8 TRCN0000274316 GCAGTCCCTATTTATTTGAAA pLKO_005 737 5UTR 100% 5.625 3.938 N IVNS1ABP n/a
9 TRCN0000021118 CGTTTGTTGAATAAGGTTGAT pLKO.1 1021 5UTR 100% 4.950 3.465 N IVNS1ABP n/a
10 TRCN0000285182 GCTTACATGCCTACCAATATT pLKO_005 3157 3UTR 100% 15.000 9.000 N IVNS1ABP n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7951 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.