Transcript: Human XM_017000086.2

PREDICTED: Homo sapiens centromere protein F (CENPF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CENPF (1063)
Length:
9804
CDS:
162..9506

Additional Resources:

NCBI RefSeq record:
XM_017000086.2
NBCI Gene record:
CENPF (1063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062676 CGTGAAGATATTGGAGATAAT pLKO.1 5796 CDS 100% 13.200 18.480 N CENPF n/a
2 TRCN0000288969 CGTGAAGATATTGGAGATAAT pLKO_005 5796 CDS 100% 13.200 18.480 N CENPF n/a
3 TRCN0000062673 CCATTCCTCTACTGCAATGTA pLKO.1 9711 3UTR 100% 5.625 3.938 N CENPF n/a
4 TRCN0000288970 CCATTCCTCTACTGCAATGTA pLKO_005 9711 3UTR 100% 5.625 3.938 N CENPF n/a
5 TRCN0000062675 GCAGCATGAATTACAGACAAT pLKO.1 3863 CDS 100% 4.950 3.465 N CENPF n/a
6 TRCN0000288968 GCAGCATGAATTACAGACAAT pLKO_005 3863 CDS 100% 4.950 3.465 N CENPF n/a
7 TRCN0000062677 GCGAGTCAGATCAAGGAGAAT pLKO.1 1566 CDS 100% 4.950 3.465 N CENPF n/a
8 TRCN0000288967 GCGAGTCAGATCAAGGAGAAT pLKO_005 1566 CDS 100% 4.950 3.465 N CENPF n/a
9 TRCN0000062674 CCCAAGAGAATGGGACTCTTA pLKO.1 3079 CDS 100% 0.495 0.347 N CENPF n/a
10 TRCN0000288986 CCCAAGAGAATGGGACTCTTA pLKO_005 3079 CDS 100% 0.495 0.347 N CENPF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000086.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.