Transcript: Human XM_017000115.1

PREDICTED: Homo sapiens mannosidase alpha class 1A member 2 (MAN1A2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAN1A2 (10905)
Length:
1858
CDS:
792..1781

Additional Resources:

NCBI RefSeq record:
XM_017000115.1
NBCI Gene record:
MAN1A2 (10905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359349 AGGCCTACTTGCAGCATATTA pLKO_005 1610 CDS 100% 15.000 10.500 N MAN1A2 n/a
2 TRCN0000359280 TGAAGTCAACATTCGATTTAT pLKO_005 1586 CDS 100% 15.000 10.500 N MAN1A2 n/a
3 TRCN0000049629 GCATGGTTGATGTCAGATAAA pLKO.1 1795 3UTR 100% 13.200 9.240 N MAN1A2 n/a
4 TRCN0000049630 CCATAGTAGATGCTTTGGATA pLKO.1 1468 CDS 100% 4.950 3.465 N MAN1A2 n/a
5 TRCN0000049628 GCAGAAATTCAGACAGAGAAA pLKO.1 1194 CDS 100% 4.950 2.970 N MAN1A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.