Transcript: Human XM_017000165.1

PREDICTED: Homo sapiens lysophospholipase 2 (LYPLA2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYPLA2 (11313)
Length:
2072
CDS:
489..1205

Additional Resources:

NCBI RefSeq record:
XM_017000165.1
NBCI Gene record:
LYPLA2 (11313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294418 GGCTGCTTTCTTATCCATTTC pLKO_005 1472 3UTR 100% 10.800 7.560 N LYPLA2 n/a
2 TRCN0000051110 CCTCACGTCAAGTACATCTGT pLKO.1 636 CDS 100% 3.000 1.800 N LYPLA2 n/a
3 TRCN0000287088 CCTCACGTCAAGTACATCTGT pLKO_005 636 CDS 100% 3.000 1.800 N LYPLA2 n/a
4 TRCN0000051109 GCAGCTGTGAAGGAATTTCTT pLKO.1 1221 3UTR 100% 5.625 2.813 Y LYPLA2 n/a
5 TRCN0000287018 GCAGCTGTGAAGGAATTTCTT pLKO_005 1221 3UTR 100% 5.625 2.813 Y LYPLA2 n/a
6 TRCN0000051111 CAGGGTCCAGTTCAAGACATA pLKO.1 1082 CDS 100% 4.950 2.475 Y LYPLA2 n/a
7 TRCN0000287017 CAGGGTCCAGTTCAAGACATA pLKO_005 1082 CDS 100% 4.950 2.475 Y LYPLA2 n/a
8 TRCN0000051108 GCATGAAATGAAGAACGGGAT pLKO.1 800 CDS 100% 2.160 1.080 Y LYPLA2 n/a
9 TRCN0000287016 GCATGAAATGAAGAACGGGAT pLKO_005 800 CDS 100% 2.160 1.080 Y LYPLA2 n/a
10 TRCN0000051112 CGAATCGTCCTGGGAGGCTTT pLKO.1 831 CDS 100% 1.350 0.675 Y LYPLA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000165.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.