Transcript: Human XM_017000410.1

PREDICTED: Homo sapiens GLIS family zinc finger 1 (GLIS1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLIS1 (148979)
Length:
2993
CDS:
224..2611

Additional Resources:

NCBI RefSeq record:
XM_017000410.1
NBCI Gene record:
GLIS1 (148979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107707 GTCTCTGGTCACCTGTGTAAA pLKO.1 1033 CDS 100% 13.200 9.240 N GLIS1 n/a
2 TRCN0000107706 CCCAACAAGTGCATGTTTGAA pLKO.1 1529 CDS 100% 5.625 3.938 N GLIS1 n/a
3 TRCN0000433577 CCATCTACACAGACACCTGAA pLKO_005 2592 CDS 100% 4.050 2.835 N GLIS1 n/a
4 TRCN0000107705 GCCCTGTAACATTCCCTCGAT pLKO.1 2832 3UTR 100% 2.640 1.848 N GLIS1 n/a
5 TRCN0000107709 CCAGGGCAGTTTCCACTCCAT pLKO.1 2290 CDS 100% 0.880 0.616 N GLIS1 n/a
6 TRCN0000107708 CCACCTAGACACGAAGCCGTA pLKO.1 1693 CDS 100% 0.720 0.504 N GLIS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000410.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.