Transcript: Human XM_017000766.2

PREDICTED: Homo sapiens regulation of nuclear pre-mRNA domain containing 2 (RPRD2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RPRD2 (23248)
Length:
2249
CDS:
4..2046

Additional Resources:

NCBI RefSeq record:
XM_017000766.2
NBCI Gene record:
RPRD2 (23248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338838 TTTCGATCTCAGGCCCTAATT pLKO_005 487 CDS 100% 13.200 18.480 N RPRD2 n/a
2 TRCN0000141869 GCTTTGCCAAACCTGGCTAAT pLKO.1 1255 CDS 100% 10.800 7.560 N RPRD2 n/a
3 TRCN0000143089 CGCTCAGAAGATCAGATAGAA pLKO.1 529 CDS 100% 5.625 3.938 N RPRD2 n/a
4 TRCN0000122133 GCTGCTCTCAAGTCTAAGATA pLKO.1 457 CDS 100% 5.625 3.938 N RPRD2 n/a
5 TRCN0000338900 GCTGCTCTCAAGTCTAAGATA pLKO_005 457 CDS 100% 5.625 3.938 N RPRD2 n/a
6 TRCN0000143134 CCTGTGACAGATAATCGTGAT pLKO.1 1006 CDS 100% 4.050 2.835 N RPRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000766.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.