Transcript: Human XM_017000827.2

PREDICTED: Homo sapiens ubiquitin protein ligase E3 component n-recognin 4 (UBR4), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBR4 (23352)
Length:
19978
CDS:
3971..19654

Additional Resources:

NCBI RefSeq record:
XM_017000827.2
NBCI Gene record:
UBR4 (23352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000827.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154886 CGGACCATCAACCTGTATTAT pLKO.1 14864 CDS 100% 15.000 21.000 N UBR4 n/a
2 TRCN0000152115 CCACCATCAAAGACTTACATT pLKO.1 7124 CDS 100% 5.625 7.875 N UBR4 n/a
3 TRCN0000155927 CGAGCCATTCTACTCATCTTT pLKO.1 4294 CDS 100% 5.625 7.875 N UBR4 n/a
4 TRCN0000157737 CCGCTGGTAGTTATGGTGAAA pLKO.1 10661 CDS 100% 4.950 6.930 N UBR4 n/a
5 TRCN0000155202 GCCGACTAGATAGAACTGAAA pLKO.1 4506 CDS 100% 4.950 6.930 N UBR4 n/a
6 TRCN0000155617 CCACATACATTGTTCGGGAAA pLKO.1 8571 CDS 100% 4.050 5.670 N UBR4 n/a
7 TRCN0000157658 GCCGCTGATGAGGGATATAAA pLKO.1 17242 CDS 100% 15.000 12.000 N UBR4 n/a
8 TRCN0000154749 GCTGTGAGCTTCTCTTGTAAA pLKO.1 12176 CDS 100% 13.200 9.240 N UBR4 n/a
9 TRCN0000154429 GCTGTTCGTAATGGCTTTCAT pLKO.1 4964 CDS 100% 5.625 3.938 N UBR4 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2795 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000827.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.