Transcript: Human XM_017000927.1

PREDICTED: Homo sapiens collagen type XXIV alpha 1 chain (COL24A1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
COL24A1 (255631)
Length:
7542
CDS:
368..5503

Additional Resources:

NCBI RefSeq record:
XM_017000927.1
NBCI Gene record:
COL24A1 (255631)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017000927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419258 TGAACTACCTTAGCAATTTAT pLKO_005 4920 CDS 100% 15.000 21.000 N COL24A1 n/a
2 TRCN0000117068 GCTGCTATTCAAGCCTTGATT pLKO.1 4814 CDS 100% 5.625 7.875 N COL24A1 n/a
3 TRCN0000117070 CGCCCAAACTATTTGCTGAAA pLKO.1 1176 CDS 100% 4.950 6.930 N COL24A1 n/a
4 TRCN0000434905 TGCAATTAGGAGTACAATTAC pLKO_005 759 CDS 100% 13.200 10.560 N COL24A1 n/a
5 TRCN0000117067 CCGGTGATACACTACCTCTTA pLKO.1 5977 3UTR 100% 4.950 3.960 N COL24A1 n/a
6 TRCN0000418617 GTACTGTCAGAGGATACATTT pLKO_005 1199 CDS 100% 13.200 9.240 N COL24A1 n/a
7 TRCN0000117069 GCAGACAAATACCAACCTGAA pLKO.1 1100 CDS 100% 4.050 2.835 N COL24A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017000927.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.