Transcript: Human XM_017001118.2

PREDICTED: Homo sapiens hippocalcin (HPCA), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HPCA (3208)
Length:
1877
CDS:
513..1094

Additional Resources:

NCBI RefSeq record:
XM_017001118.2
NBCI Gene record:
HPCA (3208)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056323 GCCAAAGCAAGTAAGCGGTTA pLKO.1 1260 3UTR 100% 4.050 5.670 N HPCA n/a
2 TRCN0000104706 CCGCCAAATGGACACAAACAA pLKO.1 971 CDS 100% 5.625 3.938 N Hpca n/a
3 TRCN0000412268 CCATAGACTTTCGGGAGTTCA pLKO_005 748 CDS 100% 4.950 3.465 N HPCA n/a
4 TRCN0000429770 GATGGTTTCGTCCGTGATGAA pLKO_005 902 CDS 100% 4.950 3.465 N HPCA n/a
5 TRCN0000056325 TCCGCCAAATGGACACAAACA pLKO.1 970 CDS 100% 4.950 3.465 N HPCA n/a
6 TRCN0000425265 TCCTCAATGTGGATGAGTTCA pLKO_005 637 CDS 100% 4.950 3.465 N HPCA n/a
7 TRCN0000056324 ACCTTTGACACCAACAGCGAT pLKO.1 723 CDS 100% 2.640 1.848 N HPCA n/a
8 TRCN0000056327 CCCGTCCATCGTGCGTCTGCT pLKO.1 1040 CDS 100% 0.000 0.000 N HPCA n/a
9 TRCN0000429321 CAAGTTTGCCGAGCACGTCTT pLKO_005 698 CDS 100% 4.050 2.430 N Hpca n/a
10 TRCN0000428224 TCATGTGGGCCTTCAGCATGT pLKO_005 814 CDS 100% 4.050 2.430 N HPCA n/a
11 TRCN0000431229 TCATGTGGGCCTTCAGCATGT pLKO_005 814 CDS 100% 4.050 2.430 N Hpca n/a
12 TRCN0000056326 GAACACAGAGTTCTCAGAGCT pLKO.1 566 CDS 100% 2.640 1.584 N HPCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001118.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.