Transcript: Human XM_017001216.2

PREDICTED: Homo sapiens spermatogenesis associated 21 (SPATA21), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPATA21 (374955)
Length:
2909
CDS:
318..2453

Additional Resources:

NCBI RefSeq record:
XM_017001216.2
NBCI Gene record:
SPATA21 (374955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056361 CCGCAGCTACTTTGAGATCTT pLKO.1 1673 CDS 100% 4.950 6.930 N SPATA21 n/a
2 TRCN0000427916 GTTGCAGAAGCTTCCCTACAA pLKO_005 2069 CDS 100% 4.950 3.960 N SPATA21 n/a
3 TRCN0000056362 GCAGTCTTAGAGGAAATCACA pLKO.1 1974 CDS 100% 3.000 2.400 N SPATA21 n/a
4 TRCN0000433253 TGATGAGTGCTGATGTCAATG pLKO_005 1786 CDS 100% 10.800 7.560 N SPATA21 n/a
5 TRCN0000056359 CCAGTCAGGATCTCAAGGAAA pLKO.1 2324 CDS 100% 4.950 3.465 N SPATA21 n/a
6 TRCN0000424318 CTCTACTCTTTGAGATCCTGT pLKO_005 1921 CDS 100% 2.640 1.848 N SPATA21 n/a
7 TRCN0000056360 CTGAAGAATATCCTGCTCCTA pLKO.1 1725 CDS 100% 2.640 1.848 N SPATA21 n/a
8 TRCN0000056358 GCTCAGAAGTTCCAGAACGAA pLKO.1 2107 CDS 100% 3.000 1.800 N SPATA21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001216.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.