Transcript: Human XM_017001256.1

PREDICTED: Homo sapiens immunoglobulin like domain containing receptor 2 (ILDR2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ILDR2 (387597)
Length:
7918
CDS:
184..1767

Additional Resources:

NCBI RefSeq record:
XM_017001256.1
NBCI Gene record:
ILDR2 (387597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434781 ATTGCCTATGCCTACAATATG pLKO_005 2122 3UTR 100% 13.200 18.480 N ILDR2 n/a
2 TRCN0000159384 GCGGACTCTATTACTGTATTA pLKO.1 647 CDS 100% 13.200 18.480 N ILDR2 n/a
3 TRCN0000417154 AGCAATTTCCGCCAGTCTTTC pLKO_005 886 CDS 100% 10.800 8.640 N ILDR2 n/a
4 TRCN0000159285 GCAGATATAACAACACCATCT pLKO.1 836 CDS 100% 4.050 3.240 N ILDR2 n/a
5 TRCN0000423537 GGTCTGATGTTGTCAACATTT pLKO_005 1761 CDS 100% 13.200 9.240 N ILDR2 n/a
6 TRCN0000426260 ATGAAGGTCCTGTACTATGTT pLKO_005 772 CDS 100% 5.625 3.938 N ILDR2 n/a
7 TRCN0000166337 CTACATGAGGAGGACAGCAAT pLKO.1 871 CDS 100% 4.950 3.465 N ILDR2 n/a
8 TRCN0000166072 GCAGTGGAAGTTCAAGTCCTA pLKO.1 390 CDS 100% 2.640 1.848 N ILDR2 n/a
9 TRCN0000158983 GCAAGAATGTGTGAGAACATT pLKO.1 1982 3UTR 100% 0.563 0.394 N ILDR2 n/a
10 TRCN0000158820 GCTTACCAAGAAAGCAAGAAT pLKO.1 1969 3UTR 100% 5.625 3.375 N ILDR2 n/a
11 TRCN0000165738 CTCAGCAAGAGAAACCTGGAA pLKO.1 466 CDS 100% 2.640 1.584 N ILDR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.