Transcript: Human XM_017001353.1

PREDICTED: Homo sapiens protein phosphatase 1 regulatory subunit 12B (PPP1R12B), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPP1R12B (4660)
Length:
9548
CDS:
913..1539

Additional Resources:

NCBI RefSeq record:
XM_017001353.1
NBCI Gene record:
PPP1R12B (4660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006847 CCTCCACCTATGTATCAACTT pLKO.1 3 5UTR 100% 4.950 6.930 N PPP1R12B n/a
2 TRCN0000006845 CCGCACTTTAAGCACACACTT pLKO.1 5919 3UTR 100% 4.950 3.960 N PPP1R12B n/a
3 TRCN0000231500 AGCTAGAGCTAGCAGATATAA pLKO_005 1301 CDS 100% 15.000 10.500 N PPP1R12B n/a
4 TRCN0000231501 TATCTTGAGACTTCGTATTAT pLKO_005 4002 3UTR 100% 15.000 10.500 N PPP1R12B n/a
5 TRCN0000006849 CCTGCTATGGACAAATAGATT pLKO.1 834 5UTR 100% 5.625 3.938 N PPP1R12B n/a
6 TRCN0000006846 CGTGGCATGAAAGACTTTCTA pLKO.1 1076 CDS 100% 5.625 3.938 N PPP1R12B n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3603 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001353.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.