Transcript: Human XM_017001806.1

PREDICTED: Homo sapiens CTTNBP2 N-terminal like (CTTNBP2NL), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTTNBP2NL (55917)
Length:
5704
CDS:
667..2586

Additional Resources:

NCBI RefSeq record:
XM_017001806.1
NBCI Gene record:
CTTNBP2NL (55917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244710 ATAACCCAGTTAGGTATTATA pLKO_005 5153 3UTR 100% 15.000 21.000 N CTTNBP2NL n/a
2 TRCN0000168045 CTTTGGCACAGACTATCGAAA pLKO.1 2250 CDS 100% 4.950 6.930 N CTTNBP2NL n/a
3 TRCN0000244709 CTGAACTCCTGACACTATTTA pLKO_005 692 CDS 100% 15.000 10.500 N CTTNBP2NL n/a
4 TRCN0000244707 GCCCTCCATCCAGGGATTTAT pLKO_005 2108 CDS 100% 15.000 10.500 N CTTNBP2NL n/a
5 TRCN0000244711 GGTACTCACTAAGCGTTTATT pLKO_005 1959 CDS 100% 15.000 10.500 N CTTNBP2NL n/a
6 TRCN0000244708 GCCACTCCTGCTTACTCATAT pLKO_005 1681 CDS 100% 13.200 9.240 N CTTNBP2NL n/a
7 TRCN0000167107 CGTTTGACATTCCATCAGATT pLKO.1 2607 3UTR 100% 4.950 3.465 N CTTNBP2NL n/a
8 TRCN0000166934 GACCTTGTTATAGAAGCCTTA pLKO.1 742 CDS 100% 4.050 2.835 N CTTNBP2NL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.