Transcript: Human XM_017001838.1

PREDICTED: Homo sapiens formin 2 (FMN2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FMN2 (56776)
Length:
4478
CDS:
224..4378

Additional Resources:

NCBI RefSeq record:
XM_017001838.1
NBCI Gene record:
FMN2 (56776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377566 GCTCGGACACGGACATCTATA pLKO_005 756 CDS 100% 13.200 18.480 N FMN2 n/a
2 TRCN0000365637 TGCTTCAGGGAACCGTGTAAT pLKO_005 1952 CDS 100% 13.200 9.240 N FMN2 n/a
3 TRCN0000447130 TGCTTCAGGGAACCGTGTAAT pLKO_005 1952 CDS 100% 13.200 9.240 N Fmn2 n/a
4 TRCN0000365565 TTGTGTCTCCAAGGCGAATAT pLKO_005 2598 CDS 100% 13.200 9.240 N FMN2 n/a
5 TRCN0000123006 CCAGGATTCAACTACATAGTA pLKO.1 4131 CDS 100% 5.625 3.938 N FMN2 n/a
6 TRCN0000123005 CCATTCTATTTCTACCGAGTT pLKO.1 2725 CDS 100% 4.050 2.835 N FMN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.