Transcript: Human XM_017001886.1

PREDICTED: Homo sapiens leucine rich repeat containing 7 (LRRC7), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC7 (57554)
Length:
10184
CDS:
207..4991

Additional Resources:

NCBI RefSeq record:
XM_017001886.1
NBCI Gene record:
LRRC7 (57554)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146764 CCAACCACTATTGCTAGTTTA pLKO.1 630 CDS 100% 13.200 18.480 N LRRC7 n/a
2 TRCN0000146740 CGGAATCTTCTAAAGGTGTTA pLKO.1 3124 CDS 100% 4.950 3.960 N LRRC7 n/a
3 TRCN0000252705 AGACTTGACCTAGGCAATAAT pLKO_005 939 CDS 100% 15.000 10.500 N Lrrc7 n/a
4 TRCN0000147187 CCTGAAGTTCTGGATCAAATA pLKO.1 975 CDS 100% 13.200 9.240 N LRRC7 n/a
5 TRCN0000148510 CCAGCAATTTCAGTCACCATT pLKO.1 4592 CDS 100% 4.950 3.465 N LRRC7 n/a
6 TRCN0000149954 GCCAACAGTAATCCTCTCTTA pLKO.1 2742 CDS 100% 4.950 3.465 N LRRC7 n/a
7 TRCN0000252708 CCTCCGGACACCATTACTAAA pLKO_005 4470 CDS 100% 13.200 9.240 N Lrrc7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001886.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.