Transcript: Human XM_017001959.1

PREDICTED: Homo sapiens RAB13, member RAS oncogene family (RAB13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RAB13 (5872)
Length:
954
CDS:
138..506

Additional Resources:

NCBI RefSeq record:
XM_017001959.1
NBCI Gene record:
RAB13 (5872)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000343560 CATGGGCATTATCCTAGTATA pLKO_005 137 5UTR 100% 13.200 18.480 N RAB13 n/a
2 TRCN0000048118 CGAGAGCATGGAATCCGATTT pLKO.1 315 CDS 100% 10.800 15.120 N RAB13 n/a
3 TRCN0000343509 GTCACATAGGTAGATGGTAAA pLKO_005 602 3UTR 100% 10.800 15.120 N RAB13 n/a
4 TRCN0000048122 CGAGAATATTCAGAACTGGAT pLKO.1 182 CDS 100% 2.640 3.696 N RAB13 n/a
5 TRCN0000380598 GTGCTAAATCCAGTATGAATG pLKO_005 346 CDS 100% 10.800 8.640 N RAB13 n/a
6 TRCN0000382005 AGAAGGAGCAGGCCGATAAGT pLKO_005 289 CDS 100% 5.625 4.500 N RAB13 n/a
7 TRCN0000048121 GACAATAACTACTGCCTACTA pLKO.1 107 5UTR 100% 4.950 3.960 N RAB13 n/a
8 TRCN0000352881 AGATCCGCACTGTGGATATAG pLKO_005 31 5UTR 100% 13.200 9.240 N RAB13 n/a
9 TRCN0000343510 ATGAGAAATCTTTCGAGAATA pLKO_005 169 CDS 100% 13.200 9.240 N RAB13 n/a
10 TRCN0000048119 CCATGGGCATTATCCTAGTAT pLKO.1 136 5UTR 100% 5.625 3.938 N RAB13 n/a
11 TRCN0000381900 GAGATCAGGAAACGGCAACAA pLKO_005 422 CDS 100% 4.950 3.465 N RAB13 n/a
12 TRCN0000379551 TCGAGAGCATGGAATCCGATT pLKO_005 314 CDS 100% 4.050 2.835 N RAB13 n/a
13 TRCN0000381528 AGAGCGGTTCAAGACAATAAC pLKO_005 95 5UTR 100% 13.200 7.920 N RAB13 n/a
14 TRCN0000381967 AGAAGGCAAGGAGGTAGGAAG pLKO_005 719 3UTR 100% 4.050 2.430 N RAB13 n/a
15 TRCN0000381143 CAAGAAGAACACCAACAAGTG pLKO_005 473 CDS 100% 4.050 2.430 N RAB13 n/a
16 TRCN0000382303 GAAGATCAAACTACAAGTCTG pLKO_005 59 5UTR 100% 4.050 2.430 N RAB13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001959.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.