Transcript: Human XM_017001992.1

PREDICTED: Homo sapiens HIVEP zinc finger 3 (HIVEP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIVEP3 (59269)
Length:
13398
CDS:
2275..9495

Additional Resources:

NCBI RefSeq record:
XM_017001992.1
NBCI Gene record:
HIVEP3 (59269)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017001992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244253 TCTGAGGCTGTGAATAGTTTA pLKO_005 9744 3UTR 100% 13.200 18.480 N HIVEP3 n/a
2 TRCN0000236165 CAAGAAGGTACGGACTCAAAG pLKO_005 7024 CDS 100% 10.800 15.120 N HIVEP3 n/a
3 TRCN0000236164 GGTTCCTGAGATCCTAGTAAC pLKO_005 4836 CDS 100% 10.800 15.120 N HIVEP3 n/a
4 TRCN0000018900 CGCTGGTTGGTGCATAAGTTT pLKO.1 7155 CDS 100% 5.625 7.875 N HIVEP3 n/a
5 TRCN0000018903 CGCAAACACTCGCTAACCAAA pLKO.1 8221 CDS 100% 4.950 6.930 N HIVEP3 n/a
6 TRCN0000244408 AGTACTGAGTCTGGGTATTTC pLKO_005 3436 CDS 100% 13.200 9.240 N HIVEP3 n/a
7 TRCN0000244409 GCCACAGCAGTCACGTGTTTA pLKO_005 3995 CDS 100% 13.200 9.240 N HIVEP3 n/a
8 TRCN0000018901 GCCTTGAACTTACCATGGAAA pLKO.1 6584 CDS 100% 4.950 3.465 N HIVEP3 n/a
9 TRCN0000018904 CCCTCATCAGTTCTTAGGGAA pLKO.1 2458 CDS 100% 2.640 1.848 N HIVEP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017001992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.