Transcript: Human XM_017002014.2

PREDICTED: Homo sapiens Rh blood group CcEe antigens (RHCE), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RHCE (6006)
Length:
3469
CDS:
556..1692

Additional Resources:

NCBI RefSeq record:
XM_017002014.2
NBCI Gene record:
RHCE (6006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433664 CATTAGGATGATGCTATCAAT pLKO_005 1813 3UTR 100% 5.625 3.938 N RHCE n/a
2 TRCN0000060058 GCCATGTTCAACACCTACTAT pLKO.1 1264 CDS 100% 5.625 3.375 N RHCE n/a
3 TRCN0000060059 GCTCTCATTCTCCTCTTCTAT pLKO.1 622 CDS 100% 5.625 2.813 Y RHCE n/a
4 TRCN0000082938 CCTGCATTTGTACGTGAGAAA pLKO.1 1663 CDS 100% 4.950 2.475 Y RHD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002014.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.