Transcript: Human XM_017002026.1

PREDICTED: Homo sapiens BCL9 transcription coactivator (BCL9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BCL9 (607)
Length:
5973
CDS:
657..4715

Additional Resources:

NCBI RefSeq record:
XM_017002026.1
NBCI Gene record:
BCL9 (607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356325 GCGGAAGCCCTTGGATATATC pLKO_005 2960 CDS 100% 13.200 18.480 N BCL9 n/a
2 TRCN0000356398 TGGATTTGCAGGCATGATAAA pLKO_005 2123 CDS 100% 13.200 10.560 N BCL9 n/a
3 TRCN0000005512 CCTGAGGAGATGCTGAAATTA pLKO.1 2664 CDS 100% 15.000 10.500 N BCL9 n/a
4 TRCN0000356324 TTTGATCTATCCCGCATTATT pLKO_005 4134 CDS 100% 15.000 10.500 N BCL9 n/a
5 TRCN0000005513 CCAACTCAACTCCCAACAATA pLKO.1 1348 CDS 100% 13.200 9.240 N BCL9 n/a
6 TRCN0000005509 GCTGCAATACACAGTGTTATT pLKO.1 5569 3UTR 100% 13.200 9.240 N BCL9 n/a
7 TRCN0000314150 ATCCTTGTCAAGATGAGATTC pLKO_005 4738 3UTR 100% 10.800 7.560 N Bcl9 n/a
8 TRCN0000005510 GCAGGCATGATAAACTCTGAA pLKO.1 2130 CDS 100% 4.950 3.465 N BCL9 n/a
9 TRCN0000005511 CCTCTGTGAATATCCCTGGAA pLKO.1 3370 CDS 100% 2.640 1.848 N BCL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.