Transcript: Human XM_017002084.1

PREDICTED: Homo sapiens major facilitator superfamily domain containing 14A (MFSD14A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MFSD14A (64645)
Length:
2884
CDS:
310..1716

Additional Resources:

NCBI RefSeq record:
XM_017002084.1
NBCI Gene record:
MFSD14A (64645)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059674 CGGCTTAATTCAAGGAGTAAA pLKO.1 465 CDS 100% 13.200 18.480 N MFSD14A n/a
2 TRCN0000415979 GCTTATCTTGGACGAGTATAT pLKO_005 778 CDS 100% 13.200 18.480 N MFSD14A n/a
3 TRCN0000434030 GTTTACTTATGAGGTCAATTG pLKO_005 1148 CDS 100% 10.800 15.120 N MFSD14A n/a
4 TRCN0000059676 GCCTTGTTTATTCCGGAACAT pLKO.1 1576 CDS 100% 4.950 6.930 N MFSD14A n/a
5 TRCN0000059675 GCAGCGTTTATAGCAGTCCTT pLKO.1 1090 CDS 100% 2.640 3.696 N MFSD14A n/a
6 TRCN0000413149 TTATACCTCAGACAGATAATG pLKO_005 1048 CDS 100% 13.200 10.560 N MFSD14A n/a
7 TRCN0000102120 CCTCAACACTTGAATACATAA pLKO.1 2455 3UTR 100% 13.200 9.240 N Mfsd14a n/a
8 TRCN0000308941 CCTCAACACTTGAATACATAA pLKO_005 2455 3UTR 100% 13.200 9.240 N Mfsd14a n/a
9 TRCN0000059673 CGGCCCTCTATGGATTCATTT pLKO.1 1400 CDS 100% 13.200 9.240 N MFSD14A n/a
10 TRCN0000424652 GCAATAGCTTTGCTAGATATT pLKO_005 829 CDS 100% 13.200 9.240 N MFSD14A n/a
11 TRCN0000417193 TCCATCCACAGTGTACTTTAA pLKO_005 1794 3UTR 100% 13.200 9.240 N MFSD14A n/a
12 TRCN0000414642 TTGTTTATTAGCACCAATTTC pLKO_005 1923 3UTR 100% 13.200 9.240 N MFSD14A n/a
13 TRCN0000059677 CCCACCTTGGTGGTATTACAT pLKO.1 412 CDS 100% 5.625 3.938 N MFSD14A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.