Transcript: Human XM_017002128.1

PREDICTED: Homo sapiens SKI proto-oncogene (SKI), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SKI (6497)
Length:
5490
CDS:
342..2042

Additional Resources:

NCBI RefSeq record:
XM_017002128.1
NBCI Gene record:
SKI (6497)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235448 ACGTCTTACCGTGCCTATTAC pLKO_005 2147 3UTR 100% 13.200 10.560 N SKI n/a
2 TRCN0000235449 CAGTGTCAGCGAGTGAGAAAG pLKO_005 1003 CDS 100% 10.800 7.560 N SKI n/a
3 TRCN0000039712 AGACAGCTTCTACTCCTACAA pLKO.1 1055 CDS 100% 4.950 3.465 N SKI n/a
4 TRCN0000235450 CCTGCATGAGGTGGTCAAGAT pLKO_005 1541 CDS 100% 4.950 3.465 N SKI n/a
5 TRCN0000010438 CACATGACGCCATCTGAAGAC pLKO.1 2417 3UTR 100% 4.050 2.835 N SKI n/a
6 TRCN0000010437 GATCGAAGACCTGCAGGTGAA pLKO.1 1853 CDS 100% 4.050 2.835 N SKI n/a
7 TRCN0000039709 GCCAAAGAGAAGTTCCTGCAT pLKO.1 1527 CDS 100% 2.640 1.848 N SKI n/a
8 TRCN0000010439 GAATCTGCCACTCTCAGAATA pLKO.1 3269 3UTR 100% 13.200 7.920 N SKI n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002128.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.