Transcript: Human XM_017002260.2

PREDICTED: Homo sapiens PR/SET domain 2 (PRDM2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRDM2 (7799)
Length:
7072
CDS:
587..5140

Additional Resources:

NCBI RefSeq record:
XM_017002260.2
NBCI Gene record:
PRDM2 (7799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230071 ACAGCGGATGCGGAGATTAAA pLKO_005 4532 CDS 100% 15.000 21.000 N PRDM2 n/a
2 TRCN0000230070 AGAGCTTTACACGACTATAAA pLKO_005 3784 CDS 100% 15.000 21.000 N PRDM2 n/a
3 TRCN0000013102 CGTCGAATAAGCTCAAATTAA pLKO.1 4221 CDS 100% 15.000 21.000 N PRDM2 n/a
4 TRCN0000013100 GCCTACGTGTAGTGCTGTAAA pLKO.1 2599 CDS 100% 13.200 18.480 N PRDM2 n/a
5 TRCN0000218523 TTCAAGAGTGAGCTATCAAAC pLKO_005 6270 3UTR 100% 10.800 15.120 N PRDM2 n/a
6 TRCN0000013099 CCGTCAATCATGCTTTCAAAT pLKO.1 1137 CDS 100% 13.200 10.560 N PRDM2 n/a
7 TRCN0000230069 GGCAGATTTGTATGGTATAAA pLKO_005 1759 CDS 100% 15.000 10.500 N PRDM2 n/a
8 TRCN0000218082 GTCACATGCATATCCATATAT pLKO_005 1113 CDS 100% 15.000 10.500 N PRDM2 n/a
9 TRCN0000013101 CCTCTGCAAATATGAGAGATT pLKO.1 576 5UTR 100% 4.950 3.465 N PRDM2 n/a
10 TRCN0000013098 CCTGACTGTAAATGCTCCATT pLKO.1 6428 3UTR 100% 4.950 3.465 N PRDM2 n/a
11 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 824 CDS 100% 4.950 2.475 Y SET n/a
12 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 824 CDS 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.