Transcript: Human XM_017002355.1

PREDICTED: Homo sapiens WD repeat domain 78 (WDR78), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR78 (79819)
Length:
3221
CDS:
192..1976

Additional Resources:

NCBI RefSeq record:
XM_017002355.1
NBCI Gene record:
WDR78 (79819)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158777 GCTATGGAACTTGTATCTTTA pLKO.1 411 CDS 100% 13.200 18.480 N WDR78 n/a
2 TRCN0000158428 CGTATTTATCAGAGTCCATAT pLKO.1 1020 CDS 100% 10.800 15.120 N WDR78 n/a
3 TRCN0000161017 GCGCTTATCACATTCCCAATT pLKO.1 2560 3UTR 100% 10.800 15.120 N WDR78 n/a
4 TRCN0000159346 GCCATTCTATGCAGTTTGTTT pLKO.1 2807 3UTR 100% 5.625 4.500 N WDR78 n/a
5 TRCN0000160666 CCATTCTCTTTGCCAAACAAA pLKO.1 1819 CDS 100% 5.625 3.938 N WDR78 n/a
6 TRCN0000161078 GAATACTGCTAACCCTGGAAT pLKO.1 1787 CDS 100% 4.950 3.465 N WDR78 n/a
7 TRCN0000162606 CCAAGTCAAACCAATCAGCAT pLKO.1 1954 CDS 100% 2.640 1.848 N WDR78 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.