Transcript: Human XM_017002484.2

PREDICTED: Homo sapiens synapse defective Rho GTPase homolog 2 (SYDE2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYDE2 (84144)
Length:
6726
CDS:
138..3824

Additional Resources:

NCBI RefSeq record:
XM_017002484.2
NBCI Gene record:
SYDE2 (84144)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247675 TAGTAGGCCTGTATCGATTAT pLKO_005 3274 CDS 100% 13.200 18.480 N SYDE2 n/a
2 TRCN0000247672 AGCCGAAAGCTAAGCGTTAAG pLKO_005 2346 CDS 100% 10.800 15.120 N SYDE2 n/a
3 TRCN0000247673 AGGTGTTCTTAAGGATTATTT pLKO_005 3398 CDS 100% 15.000 10.500 N SYDE2 n/a
4 TRCN0000247674 CTTGGACTTCTTGGGATATTT pLKO_005 4565 3UTR 100% 15.000 10.500 N SYDE2 n/a
5 TRCN0000247676 CCGAACATGCAGGTGATATTC pLKO_005 2005 CDS 100% 13.200 9.240 N SYDE2 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4969 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4969 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002484.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.