Transcript: Human XM_017002516.1

PREDICTED: Homo sapiens SH3GL interacting endocytic adaptor 1 (SGIP1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGIP1 (84251)
Length:
8709
CDS:
349..2805

Additional Resources:

NCBI RefSeq record:
XM_017002516.1
NBCI Gene record:
SGIP1 (84251)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416331 GGTTCAGGCCAACCAATTAAT pLKO_005 925 CDS 100% 15.000 21.000 N SGIP1 n/a
2 TRCN0000418125 GTACTATCGCCGCTCAATTTA pLKO_005 1360 CDS 100% 15.000 21.000 N SGIP1 n/a
3 TRCN0000192995 GCCTTTGGAATACGGAAGAAA pLKO.1 382 CDS 100% 5.625 4.500 N Sgip1 n/a
4 TRCN0000116642 CCCTCTCTACAGTTTCGCAAA pLKO.1 3609 3UTR 100% 4.050 3.240 N SGIP1 n/a
5 TRCN0000116646 GCTGAGCAGACCTTCATTAAA pLKO.1 1402 CDS 100% 15.000 10.500 N SGIP1 n/a
6 TRCN0000192408 CCAACTTCTCTGCTGTGATAA pLKO.1 2202 CDS 100% 13.200 9.240 N Sgip1 n/a
7 TRCN0000201007 CCCAAGTCTGTTGCTGTTAAT pLKO.1 1153 CDS 100% 13.200 9.240 N Sgip1 n/a
8 TRCN0000414684 TATCTGCACTTGGGATATATC pLKO_005 2899 3UTR 100% 13.200 9.240 N SGIP1 n/a
9 TRCN0000116643 CCCAAGCAAATGTATCGTTAA pLKO.1 2052 CDS 100% 10.800 7.560 N SGIP1 n/a
10 TRCN0000429716 GTTGGAGCAGGGTATCGATTT pLKO_005 2734 CDS 100% 10.800 7.560 N SGIP1 n/a
11 TRCN0000116645 GCCAAAGTTAACAAGGCCTTT pLKO.1 960 CDS 100% 4.050 2.835 N SGIP1 n/a
12 TRCN0000116644 CCCAAGCAAACCTTCTCCATT pLKO.1 2658 CDS 100% 4.950 2.970 N SGIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.