Transcript: Human XM_017002639.1

PREDICTED: Homo sapiens dedicator of cytokinesis 7 (DOCK7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOCK7 (85440)
Length:
6821
CDS:
95..6418

Additional Resources:

NCBI RefSeq record:
XM_017002639.1
NBCI Gene record:
DOCK7 (85440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244525 ACGGGACGCTTACCAACTAAA pLKO_005 2927 CDS 100% 13.200 18.480 N Dock7 n/a
2 TRCN0000376636 ACGGGACGCTTACCAACTAAA pLKO_005 2927 CDS 100% 13.200 18.480 N DOCK7 n/a
3 TRCN0000244528 GCGGATGTTTGGCACCTATTT pLKO_005 5503 CDS 100% 13.200 18.480 N Dock7 n/a
4 TRCN0000376575 TACGGCGACTAAGACCTATTA pLKO_005 1590 CDS 100% 13.200 18.480 N DOCK7 n/a
5 TRCN0000130338 GTTTGAATTATCCGTGCCTTT pLKO.1 3520 CDS 100% 4.050 5.670 N DOCK7 n/a
6 TRCN0000365143 ACGTTCTCTAAAGACTATATT pLKO_005 4852 CDS 100% 15.000 10.500 N DOCK7 n/a
7 TRCN0000370263 ATGCTGGAGGACCGGAAATAT pLKO_005 5171 CDS 100% 15.000 10.500 N DOCK7 n/a
8 TRCN0000365144 GATCCTAACAAGGCATATATT pLKO_005 5708 CDS 100% 15.000 10.500 N DOCK7 n/a
9 TRCN0000377466 TCTACCTCTGATTGGTATTAT pLKO_005 3727 CDS 100% 15.000 10.500 N DOCK7 n/a
10 TRCN0000365145 ATGACTCAAAGGTACACTATA pLKO_005 6640 3UTR 100% 13.200 9.240 N DOCK7 n/a
11 TRCN0000129042 GAGCCATACTTTGACACATAT pLKO.1 5744 CDS 100% 13.200 9.240 N DOCK7 n/a
12 TRCN0000127927 CATGCCGGTAATCTTTGGTAA pLKO.1 1888 CDS 100% 4.950 3.465 N DOCK7 n/a
13 TRCN0000131082 GCTTACTTACTCCACCTGCAT pLKO.1 3417 CDS 100% 2.640 1.848 N DOCK7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002639.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.