Transcript: Human XM_017002746.1

PREDICTED: Homo sapiens eukaryotic translation initiation factor 2B subunit gamma (EIF2B3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EIF2B3 (8891)
Length:
1710
CDS:
594..1580

Additional Resources:

NCBI RefSeq record:
XM_017002746.1
NBCI Gene record:
EIF2B3 (8891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083965 CGGAGTGAACTGATTCCATAT pLKO.1 879 CDS 100% 10.800 7.560 N EIF2B3 n/a
2 TRCN0000289406 CGGAGTGAACTGATTCCATAT pLKO_005 879 CDS 100% 10.800 7.560 N EIF2B3 n/a
3 TRCN0000083963 GCAGATTCTTTGCGCTACATA pLKO.1 398 5UTR 100% 5.625 3.938 N EIF2B3 n/a
4 TRCN0000307060 GCAGATTCTTTGCGCTACATA pLKO_005 398 5UTR 100% 5.625 3.938 N EIF2B3 n/a
5 TRCN0000083967 GCCCACCTCTACTGTTTGAAA pLKO.1 810 CDS 100% 5.625 3.938 N EIF2B3 n/a
6 TRCN0000289407 GCCCACCTCTACTGTTTGAAA pLKO_005 810 CDS 100% 5.625 3.938 N EIF2B3 n/a
7 TRCN0000267417 GGATGAAGAGCTGGTCATTAA pLKO_005 734 CDS 100% 13.200 7.920 N Eif2b3 n/a
8 TRCN0000083966 CCAGTTGGGAACAAACCTTTA pLKO.1 224 5UTR 100% 10.800 6.480 N EIF2B3 n/a
9 TRCN0000289408 CCAGTTGGGAACAAACCTTTA pLKO_005 224 5UTR 100% 10.800 6.480 N EIF2B3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002746.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.