Transcript: Human XM_017002846.2

PREDICTED: Homo sapiens CD101 molecule (CD101), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD101 (9398)
Length:
6872
CDS:
2589..5513

Additional Resources:

NCBI RefSeq record:
XM_017002846.2
NBCI Gene record:
CD101 (9398)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017002846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418436 GTCAGCCGCAAGTGATGTTAA pLKO_005 4090 CDS 100% 13.200 18.480 N CD101 n/a
2 TRCN0000157803 CCCTTGTATACAGAGCGGTTT pLKO.1 3078 CDS 100% 4.050 5.670 N CD101 n/a
3 TRCN0000151503 CTTATTCGAATCACCCACAAT pLKO.1 4221 CDS 100% 4.950 3.960 N CD101 n/a
4 TRCN0000418073 GAAGGTTTCCCAAGACTTATT pLKO_005 4709 CDS 100% 13.200 9.240 N CD101 n/a
5 TRCN0000414799 GCCTTCTCTTACGCAGTATAT pLKO_005 2868 CDS 100% 13.200 9.240 N CD101 n/a
6 TRCN0000150708 CAAGGCATTTGGTTCTTCAAT pLKO.1 3393 CDS 100% 5.625 3.938 N CD101 n/a
7 TRCN0000153761 CAAGGCTTTCTCTCTCAAGAT pLKO.1 3518 CDS 100% 4.950 3.465 N CD101 n/a
8 TRCN0000153795 CTTCTGACTAAGCTCAGCATT pLKO.1 2670 CDS 100% 4.950 3.465 N CD101 n/a
9 TRCN0000157516 GACGAAAGTGTCGCAGTCTTT pLKO.1 4286 CDS 100% 4.950 3.465 N CD101 n/a
10 TRCN0000421342 CAGTGCAAAGACTAATCTAAT pLKO_005 3035 CDS 100% 13.200 7.920 N CD101 n/a
11 TRCN0000156577 GCAACGGAATGGATTCAGGAT pLKO.1 3198 CDS 100% 2.640 1.584 N CD101 n/a
12 TRCN0000153115 GCAACTTCTAGATGAACCCAA pLKO.1 5645 3UTR 100% 2.640 1.584 N CD101 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017002846.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.