Transcript: Human XM_017003356.2

PREDICTED: Homo sapiens ubiquitin protein ligase E3 component n-recognin 3 (UBR3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBR3 (130507)
Length:
4888
CDS:
1..4839

Additional Resources:

NCBI RefSeq record:
XM_017003356.2
NBCI Gene record:
UBR3 (130507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034101 CCGTTCATGATGTGAGGCTTT pLKO.1 3905 CDS 100% 4.050 5.670 N UBR3 n/a
2 TRCN0000191533 GCACCAAAGATCAATCCATAA pLKO.1 1097 CDS 100% 10.800 8.640 N Ubr3 n/a
3 TRCN0000430285 AGCATTGACTCTGAGTATAAT pLKO_005 4540 CDS 100% 15.000 10.500 N UBR3 n/a
4 TRCN0000034099 GCAGTATATGACTGTGTTATT pLKO.1 3727 CDS 100% 13.200 9.240 N UBR3 n/a
5 TRCN0000415174 TTTGCTCATCCAGATCTTAAT pLKO_005 4662 CDS 100% 13.200 9.240 N UBR3 n/a
6 TRCN0000434283 TTAGTAGCAGAACGTAGAAAG pLKO_005 3145 CDS 100% 10.800 7.560 N UBR3 n/a
7 TRCN0000367245 TACTTAAGAGAAGGCTATAAT pLKO_005 658 CDS 100% 15.000 9.000 N Ubr3 n/a
8 TRCN0000413730 TACTTAAGAGAAGGCTATAAT pLKO_005 658 CDS 100% 15.000 9.000 N UBR3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003356.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.