Transcript: Human XM_017003636.1

PREDICTED: Homo sapiens PAS domain containing serine/threonine kinase (PASK), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PASK (23178)
Length:
4584
CDS:
146..4117

Additional Resources:

NCBI RefSeq record:
XM_017003636.1
NBCI Gene record:
PASK (23178)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199880 GCTGCAGACCTGCTTGATTAA pLKO.1 2113 CDS 100% 13.200 18.480 N PASK n/a
2 TRCN0000421925 TGTGAATCTTGCTGACTATAC pLKO_005 3907 CDS 100% 10.800 15.120 N PASK n/a
3 TRCN0000195515 CTTACGGCTGAGTATACAGTT pLKO.1 2854 CDS 100% 4.950 6.930 N PASK n/a
4 TRCN0000422561 CTCATGTGCAGGTTTGATAAA pLKO_005 4231 3UTR 100% 13.200 9.240 N PASK n/a
5 TRCN0000007053 CGCCAATATCATCAAGGTATT pLKO.1 3328 CDS 100% 10.800 7.560 N PASK n/a
6 TRCN0000199084 CGTCATGTGACAGTCTCTTTG pLKO.1 897 CDS 100% 10.800 7.560 N PASK n/a
7 TRCN0000414407 GTTACTTTAGAGATCGCAATT pLKO_005 3290 CDS 100% 10.800 7.560 N PASK n/a
8 TRCN0000199253 CCTAGACCTCTTCGCTTTCAT pLKO.1 3406 CDS 100% 5.625 3.938 N PASK n/a
9 TRCN0000007052 CAGAAGACAGTGATGCTGTAT pLKO.1 4260 3UTR 100% 4.950 3.465 N PASK n/a
10 TRCN0000194842 CATTCCAGTGTTCAACTGTTT pLKO.1 4338 3UTR 100% 4.950 3.465 N PASK n/a
11 TRCN0000007055 CCTTGCGTACAACAGCTCATT pLKO.1 1324 CDS 100% 4.950 3.465 N PASK n/a
12 TRCN0000199716 GCCCTTGCTATGGGAGTGAAT pLKO.1 1974 CDS 100% 4.950 3.465 N PASK n/a
13 TRCN0000011065 GCTGATGGAAAGCCAAGACAT pLKO.1 1513 CDS 100% 4.950 3.465 N PASK n/a
14 TRCN0000007054 GCAGCATATCACAGACCTGAT pLKO.1 958 CDS 100% 4.050 2.835 N PASK n/a
15 TRCN0000220687 CCTGGGCAAGAATATCACTTT pLKO.1 1273 CDS 100% 4.950 2.970 N Pask n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.