Transcript: Human XM_017003817.2

PREDICTED: Homo sapiens serine/threonine kinase 39 (STK39), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK39 (27347)
Length:
1673
CDS:
12..1157

Additional Resources:

NCBI RefSeq record:
XM_017003817.2
NBCI Gene record:
STK39 (27347)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001006 CGGTCAGATTCACAGGGATTT pLKO.1 77 CDS 100% 10.800 15.120 N STK39 n/a
2 TRCN0000025153 GTAGTTATAGTGGCTGCTAAT pLKO.1 1008 CDS 100% 10.800 15.120 N Stk39 n/a
3 TRCN0000196547 GTACGGCAAGTCCTTTAGAAA pLKO.1 434 CDS 100% 5.625 7.875 N STK39 n/a
4 TRCN0000413867 CACTCCGAGTTCTGCTTTATT pLKO_005 1342 3UTR 100% 15.000 10.500 N Stk39 n/a
5 TRCN0000001008 CTACACAGAAACGGTCAGATT pLKO.1 66 CDS 100% 4.950 3.465 N STK39 n/a
6 TRCN0000195205 CTTAATGACATACGATTTGAG pLKO.1 912 CDS 100% 4.950 3.465 N STK39 n/a
7 TRCN0000001005 CCTGATGAAGTGAAGCTGATT pLKO.1 1110 CDS 100% 4.950 2.970 N STK39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003817.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.