Transcript: Human XM_017004098.2

PREDICTED: Homo sapiens EMAP like 6 (EML6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EML6 (400954)
Length:
8918
CDS:
205..6105

Additional Resources:

NCBI RefSeq record:
XM_017004098.2
NBCI Gene record:
EML6 (400954)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350937 AGTCGGGAAGGAGCCATATAT pLKO_005 444 CDS 100% 15.000 21.000 N EML6 n/a
2 TRCN0000338920 CAAGAGGCAAACGGCATATAA pLKO_005 3668 CDS 100% 15.000 21.000 N EML6 n/a
3 TRCN0000338921 AGCGATATAACTGACGTAAAT pLKO_005 3775 CDS 100% 13.200 18.480 N EML6 n/a
4 TRCN0000370785 CAACTCAGTGGATGCGAATTA pLKO_005 1767 CDS 100% 13.200 18.480 N EML6 n/a
5 TRCN0000370842 TCGGTTACCCTAACCAATATG pLKO_005 6428 3UTR 100% 13.200 18.480 N EML6 n/a
6 TRCN0000344208 GGTCACCTGGAGCGCATATTT pLKO_005 4738 CDS 100% 15.000 12.000 N EML6 n/a
7 TRCN0000351003 ATGTAGCCCGCTGACGAATTT pLKO_005 6400 3UTR 100% 13.200 9.240 N EML6 n/a
8 TRCN0000370841 TGGGACACAACGACGACATTA pLKO_005 377 CDS 100% 13.200 7.920 N EML6 n/a
9 TRCN0000193265 CAGTTGACTTCTATGACCTTA pLKO.1 5606 CDS 100% 4.950 3.960 N Eml6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.