Transcript: Human XM_017004230.1

PREDICTED: Homo sapiens anoctamin 7 (ANO7), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO7 (50636)
Length:
3904
CDS:
360..2858

Additional Resources:

NCBI RefSeq record:
XM_017004230.1
NBCI Gene record:
ANO7 (50636)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164341 CCGTGTTCTTCAGCTTGTTCA pLKO.1 1300 CDS 100% 4.950 6.930 N ANO7 n/a
2 TRCN0000162028 CTTCCAGTTCGTCAACTTCTA pLKO.1 1811 CDS 100% 4.950 6.930 N ANO7 n/a
3 TRCN0000161091 GTTTGACGAGTACCTGGAAAT pLKO.1 2144 CDS 100% 10.800 7.560 N ANO7 n/a
4 TRCN0000162131 CAAGCAGGTCATCAACAACAT pLKO.1 1982 CDS 100% 4.950 3.465 N ANO7 n/a
5 TRCN0000162808 CCAGACCTACTGGAATCTTCT pLKO.1 2552 CDS 100% 4.950 3.465 N ANO7 n/a
6 TRCN0000159021 GCACCAAATTCTGTTTGAGAT pLKO.1 785 CDS 100% 4.950 3.465 N ANO7 n/a
7 TRCN0000162321 CAAGGTGTTCATCTTCCAGTT pLKO.1 1799 CDS 100% 4.050 2.835 N ANO7 n/a
8 TRCN0000160145 CCAAATTCTGTTTGAGATCCT pLKO.1 788 CDS 100% 2.640 1.848 N ANO7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.