Transcript: Human XM_017004785.2

PREDICTED: Homo sapiens ADAM metallopeptidase domain 17 (ADAM17), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAM17 (6868)
Length:
4402
CDS:
1134..2711

Additional Resources:

NCBI RefSeq record:
XM_017004785.2
NBCI Gene record:
ADAM17 (6868)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052170 CCCATGAAGAACACGTGTAAA pLKO.1 889 5UTR 100% 13.200 18.480 N ADAM17 n/a
2 TRCN0000052172 CCTATGTCGATGCTGAACAAA pLKO.1 2074 CDS 100% 5.625 7.875 N ADAM17 n/a
3 TRCN0000286913 CCTATGTCGATGCTGAACAAA pLKO_005 2074 CDS 100% 5.625 7.875 N ADAM17 n/a
4 TRCN0000087375 TCAAGTCTCCACAAGAGGTAA pLKO.1 1090 5UTR 100% 4.950 6.930 N LOC436104 n/a
5 TRCN0000294262 GAAGGTGAATCTAGCTTATTT pLKO_005 2899 3UTR 100% 15.000 10.500 N ADAM17 n/a
6 TRCN0000294261 GTTTGTCCAAAGGCTTATTAT pLKO_005 1326 CDS 100% 15.000 10.500 N ADAM17 n/a
7 TRCN0000087373 GATATGGGAACTCTTGGATTA pLKO.1 1266 CDS 100% 10.800 7.560 N LOC436104 n/a
8 TRCN0000052168 CCAGCAGCATTCGGTAAGAAA pLKO.1 381 5UTR 100% 5.625 3.938 N ADAM17 n/a
9 TRCN0000311680 CCAGCAGCATTCGGTAAGAAA pLKO_005 381 5UTR 100% 5.625 3.938 N ADAM17 n/a
10 TRCN0000052171 CCTGGTTACAACTCATGAATT pLKO.1 1436 CDS 100% 0.000 0.000 N ADAM17 n/a
11 TRCN0000286912 CCTGGTTACAACTCATGAATT pLKO_005 1436 CDS 100% 0.000 0.000 N ADAM17 n/a
12 TRCN0000052169 GCAGCGTCAGAATCGTGTTAA pLKO.1 2669 CDS 100% 13.200 18.480 N ADAM17 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3526 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.