Transcript: Human XM_017004899.2

PREDICTED: Homo sapiens sperm associated antigen 16 (SPAG16), transcript variant X20, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPAG16 (79582)
Length:
3461
CDS:
69..1124

Additional Resources:

NCBI RefSeq record:
XM_017004899.2
NBCI Gene record:
SPAG16 (79582)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151390 GCATCTTATGAACCGACTATA pLKO.1 729 CDS 100% 13.200 18.480 N SPAG16 n/a
2 TRCN0000152668 GAACCGACTATAAGGGTGTTA pLKO.1 738 CDS 100% 4.950 6.930 N SPAG16 n/a
3 TRCN0000150963 GCTAGAGAAGATTTGCTGAAA pLKO.1 609 CDS 100% 4.950 3.465 N SPAG16 n/a
4 TRCN0000153935 CCACACTTTACTGAAGGAGAA pLKO.1 770 CDS 100% 4.050 2.835 N SPAG16 n/a
5 TRCN0000152393 GCAGTACCTGAAGTAATAGAA pLKO.1 378 CDS 100% 5.625 3.375 N SPAG16 n/a
6 TRCN0000128231 GAGGACACAAACAAATGGAAA pLKO.1 999 CDS 100% 4.950 2.475 Y POT1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.