Transcript: Human XM_017004913.2

PREDICTED: Homo sapiens structural maintenance of chromosomes 6 (SMC6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMC6 (79677)
Length:
5233
CDS:
214..3546

Additional Resources:

NCBI RefSeq record:
XM_017004913.2
NBCI Gene record:
SMC6 (79677)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219949 ACCGATCCTTAAACGAATATA pLKO.1 1316 CDS 100% 15.000 21.000 N SMC6 n/a
2 TRCN0000437755 ACCTCACGGCCACCGATAATA pLKO_005 1882 CDS 100% 15.000 21.000 N SMC6 n/a
3 TRCN0000419080 AGATGGAAGTCGATCTTATAA pLKO_005 657 CDS 100% 15.000 21.000 N SMC6 n/a
4 TRCN0000219950 CACCCTACCAAGAGCTTATAA pLKO.1 4091 3UTR 100% 15.000 21.000 N SMC6 n/a
5 TRCN0000434692 CATAGAGACAGTGCTACTAAT pLKO_005 2034 CDS 100% 13.200 18.480 N SMC6 n/a
6 TRCN0000419108 TATCTTGATCTGGATAGTAAA pLKO_005 2917 CDS 100% 13.200 9.240 N SMC6 n/a
7 TRCN0000427417 GGTTGTGGCAAATAGCCTAAT pLKO_005 2001 CDS 100% 10.800 7.560 N SMC6 n/a
8 TRCN0000183231 GCCATCAGAGATAATATCAAA pLKO.1 1087 CDS 100% 5.625 3.938 N SMC6 n/a
9 TRCN0000183627 GCATCAATTCTGGACAAAGAA pLKO.1 2803 CDS 100% 5.625 3.375 N SMC6 n/a
10 TRCN0000182889 CCTGGATGAATTTGATGTCTA pLKO.1 3309 CDS 100% 4.950 2.970 N SMC6 n/a
11 TRCN0000087726 GCACTGAGCTACAATCAGAGA pLKO.1 1585 CDS 100% 2.640 1.848 N Ctrl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004913.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.