Transcript: Human XM_017005061.1

PREDICTED: Homo sapiens transmembrane protein 163 (TMEM163), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM163 (81615)
Length:
1869
CDS:
376..912

Additional Resources:

NCBI RefSeq record:
XM_017005061.1
NBCI Gene record:
TMEM163 (81615)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242797 AGCTTTGCATGGACGAATTAA pLKO_005 1504 3UTR 100% 15.000 21.000 N TMEM163 n/a
2 TRCN0000242795 CTGATCGGCCTCACCATATTT pLKO_005 817 CDS 100% 15.000 21.000 N TMEM163 n/a
3 TRCN0000242798 GACCAGTAGAGCACTCATAAC pLKO_005 684 CDS 100% 10.800 15.120 N TMEM163 n/a
4 TRCN0000172386 CGGAAGTGTTCAAGCATGACT pLKO.1 761 CDS 100% 3.000 4.200 N TMEM163 n/a
5 TRCN0000242799 GCCTTTACTGTCTCCGTTATG pLKO_005 358 5UTR 100% 10.800 7.560 N TMEM163 n/a
6 TRCN0000242796 TATTCCTTCTGTCATCCATAT pLKO_005 524 CDS 100% 10.800 7.560 N TMEM163 n/a
7 TRCN0000167052 CATCAGTATGTCACTTCCTAA pLKO.1 1371 3UTR 100% 4.950 3.465 N TMEM163 n/a
8 TRCN0000172457 CCATCCATGACCTCTCAACTA pLKO.1 560 CDS 100% 4.950 3.465 N TMEM163 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005061.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.