Transcript: Human XM_017005229.1

PREDICTED: Homo sapiens cyclin T2 (CCNT2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCNT2 (905)
Length:
4792
CDS:
663..2423

Additional Resources:

NCBI RefSeq record:
XM_017005229.1
NBCI Gene record:
CCNT2 (905)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416602 ATATCGTCTACTGCATTATTT pLKO_005 278 5UTR 100% 15.000 21.000 N CCNT2 n/a
2 TRCN0000013680 GCAAACATTCAAGCCCACATA pLKO.1 1864 CDS 100% 4.950 6.930 N CCNT2 n/a
3 TRCN0000418571 TAAACACCATGGGCCAATTTC pLKO_005 1481 CDS 100% 13.200 10.560 N CCNT2 n/a
4 TRCN0000013678 GCTGCTTGTAAGTATAACAAT pLKO.1 2952 3UTR 100% 5.625 4.500 N CCNT2 n/a
5 TRCN0000013682 GCACCATTCTTTCACCAAATT pLKO.1 244 5UTR 100% 13.200 9.240 N CCNT2 n/a
6 TRCN0000216992 CCTTCTGTCTTCAGTACAAAC pLKO.1 784 CDS 100% 10.800 7.560 N Ccnt2 n/a
7 TRCN0000454946 TTCGAAACTGGAGGGCTAATC pLKO_005 991 CDS 100% 10.800 7.560 N CCNT2 n/a
8 TRCN0000013679 CCAGGAATAATTCCTCAGAAA pLKO.1 1509 CDS 100% 4.950 3.465 N CCNT2 n/a
9 TRCN0000194589 CCTCGTGAAACTGGACAAGAA pLKO.1 2279 CDS 100% 4.950 3.465 N Ccnt2 n/a
10 TRCN0000417600 ATTTGGCACAGACATCCTATT pLKO_005 733 CDS 100% 10.800 6.480 N CCNT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.