Transcript: Human XM_017005301.2

PREDICTED: Homo sapiens SP140 nuclear body protein like (SP140L), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SP140L (93349)
Length:
1504
CDS:
78..1199

Additional Resources:

NCBI RefSeq record:
XM_017005301.2
NBCI Gene record:
SP140L (93349)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359271 GGTGTTTCACAAGTAGCAAAT pLKO_005 123 CDS 100% 10.800 15.120 N SP140L n/a
2 TRCN0000359269 CATAAGCTGGAGATATCAAAT pLKO_005 255 CDS 100% 13.200 9.240 N SP140L n/a
3 TRCN0000359341 TGACATCAAACTAAGTCTTAA pLKO_005 575 CDS 100% 13.200 9.240 N SP140L n/a
4 TRCN0000021962 CCTTGGCAAAGTGTATACAGA pLKO.1 1468 3UTR 100% 3.000 2.100 N SP140L n/a
5 TRCN0000021961 GCTTCAAGAAAGCACAAAGAT pLKO.1 987 CDS 100% 5.625 2.813 Y SP140L n/a
6 TRCN0000019225 GCAAATGAGATGAACCATCTT pLKO.1 138 CDS 100% 4.950 2.475 Y SP100 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.