Transcript: Human XM_017005676.1

PREDICTED: Homo sapiens mediator complex subunit 12L (MED12L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MED12L (116931)
Length:
10844
CDS:
402..6995

Additional Resources:

NCBI RefSeq record:
XM_017005676.1
NBCI Gene record:
MED12L (116931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235010 CATTGCAACTCCGCCTAAATT pLKO_005 5059 CDS 100% 15.000 21.000 N MED12L n/a
2 TRCN0000235011 AGATTGTTGCTTCGTACTTAA pLKO_005 7611 3UTR 100% 13.200 18.480 N MED12L n/a
3 TRCN0000052982 GCCTCCTAATTACTCGCCTAT pLKO.1 5882 CDS 100% 4.050 5.670 N MED12L n/a
4 TRCN0000235008 ACTGAACATCAACGGACTAAT pLKO_005 3026 CDS 100% 13.200 10.560 N MED12L n/a
5 TRCN0000052978 GCACTGTTCTTAGTTCAGAAT pLKO.1 3631 CDS 100% 4.950 3.960 N MED12L n/a
6 TRCN0000052980 CGGACTAATTGACTTCGCAAT pLKO.1 3038 CDS 100% 4.050 3.240 N MED12L n/a
7 TRCN0000235009 ACGATACCAAGATGACATAAA pLKO_005 5015 CDS 100% 13.200 9.240 N MED12L n/a
8 TRCN0000235007 GATGACTTGTGCCTATTATTC pLKO_005 884 CDS 100% 13.200 9.240 N MED12L n/a
9 TRCN0000052981 CCCATCAAAGATTGGAGCTTA pLKO.1 596 CDS 100% 4.950 3.465 N MED12L n/a
10 TRCN0000052979 GCGATCAGAAAGTATTGACAA pLKO.1 5345 CDS 100% 4.950 3.465 N MED12L n/a
11 TRCN0000234151 GAACATGGCTCAGCCAGAAAC pLKO_005 564 CDS 100% 10.800 6.480 N Med12l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.