Transcript: Human XM_017005793.2

PREDICTED: Homo sapiens serine palmitoyltransferase small subunit B (SPTSSB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTSSB (165679)
Length:
3459
CDS:
343..1188

Additional Resources:

NCBI RefSeq record:
XM_017005793.2
NBCI Gene record:
SPTSSB (165679)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162746 CCGGAAGACAAGCTAATAAAT pLKO.1 2984 3UTR 100% 15.000 21.000 N SPTSSB n/a
2 TRCN0000164139 CTTTAACGCAGCTTAGGCTAA pLKO.1 1088 CDS 100% 4.050 5.670 N SPTSSB n/a
3 TRCN0000166067 GCTTTAACGCAGCTTAGGCTA pLKO.1 1087 CDS 100% 2.640 3.696 N SPTSSB n/a
4 TRCN0000160797 CGGAGATAATACAGTGACTTT pLKO.1 2355 3UTR 100% 4.950 3.960 N SPTSSB n/a
5 TRCN0000160798 CACGATCCTTTCATCTATTTC pLKO.1 735 CDS 100% 13.200 9.240 N SPTSSB n/a
6 TRCN0000160825 CGAGATTAATTCTCTGCACTT pLKO.1 686 CDS 100% 4.050 2.835 N SPTSSB n/a
7 TRCN0000164443 CCGAGATTAATTCTCTGCACT pLKO.1 685 CDS 100% 2.640 1.848 N SPTSSB n/a
8 TRCN0000165486 GCCGAGATTAATTCTCTGCAC pLKO.1 684 CDS 100% 2.160 1.512 N SPTSSB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005793.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.