Transcript: Human XM_017005862.1

PREDICTED: Homo sapiens dynein axonemal heavy chain 12 (DNAH12), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAH12 (201625)
Length:
8718
CDS:
162..8636

Additional Resources:

NCBI RefSeq record:
XM_017005862.1
NBCI Gene record:
DNAH12 (201625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005862.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161763 CCAGTTTCTGATCCTGAGTTT pLKO.1 7230 CDS 100% 4.950 6.930 N DNAH12 n/a
2 TRCN0000164007 CCGGTAGCTTACTTGTTGGAA pLKO.1 8032 CDS 100% 3.000 4.200 N DNAH12 n/a
3 TRCN0000160511 CCAATGGATAAGAACCTAAAT pLKO.1 6666 CDS 100% 13.200 10.560 N DNAH12 n/a
4 TRCN0000162524 CCCTAGTGATTTCGACATTGA pLKO.1 7841 CDS 100% 4.950 3.960 N DNAH12 n/a
5 TRCN0000160054 CGAGAAATCTATGACAGTAAA pLKO.1 6618 CDS 100% 13.200 9.240 N DNAH12 n/a
6 TRCN0000159606 GCTATCAGATTCAGACTATAT pLKO.1 5594 CDS 100% 13.200 9.240 N DNAH12 n/a
7 TRCN0000160429 CCTGAGATATTTGGATTACAT pLKO.1 7671 CDS 100% 5.625 3.938 N DNAH12 n/a
8 TRCN0000159763 GCGAGAAATCTATGACAGTAA pLKO.1 6617 CDS 100% 4.950 3.465 N DNAH12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005862.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.