Transcript: Human XM_017005895.2

PREDICTED: Homo sapiens neuroligin 1 (NLGN1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NLGN1 (22871)
Length:
19459
CDS:
6944..9475

Additional Resources:

NCBI RefSeq record:
XM_017005895.2
NBCI Gene record:
NLGN1 (22871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017005895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222040 CCTGCTGACTTTATCCCATTA pLKO.1 7807 CDS 100% 10.800 7.560 N NLGN1 n/a
2 TRCN0000222043 CCTTACACACATTCAATACAT pLKO.1 9381 CDS 100% 5.625 3.938 N NLGN1 n/a
3 TRCN0000222039 GCGGATCTTCACTCAAACTTT pLKO.1 8420 CDS 100% 5.625 3.938 N NLGN1 n/a
4 TRCN0000222042 CCCAAACCAGTGATGGTGTAT pLKO.1 7517 CDS 100% 4.950 3.465 N NLGN1 n/a
5 TRCN0000222041 GCCATCAACTGACATCACTTT pLKO.1 8890 CDS 100% 4.950 2.970 N NLGN1 n/a
6 TRCN0000032019 CCCAACACTATACCAGGGATT pLKO.1 9356 CDS 100% 4.050 2.430 N Nlgn1 n/a
7 TRCN0000032023 CCTTACAAAGAACTTGTTGAT pLKO.1 8015 CDS 100% 4.950 3.465 N Nlgn1 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3422 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017005895.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.