Transcript: Human XM_017006090.2

PREDICTED: Homo sapiens glycerol kinase 5 (GK5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GK5 (256356)
Length:
3301
CDS:
766..1653

Additional Resources:

NCBI RefSeq record:
XM_017006090.2
NBCI Gene record:
GK5 (256356)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377598 TGGATTACAGGCTCCATTAAA pLKO_005 1197 CDS 100% 15.000 21.000 N GK5 n/a
2 TRCN0000359785 TTCAATTTGTTGCCGTAATAA pLKO_005 343 5UTR 100% 15.000 21.000 N GK5 n/a
3 TRCN0000078665 GCAGGAATACAGATGAATCAA pLKO.1 381 5UTR 100% 5.625 4.500 N GK5 n/a
4 TRCN0000370735 TCCAAAGGACATTAGTCATTT pLKO_005 1893 3UTR 100% 13.200 9.240 N GK5 n/a
5 TRCN0000359717 TTGAAGCCTTCTACCAGTAAA pLKO_005 1249 CDS 100% 13.200 9.240 N GK5 n/a
6 TRCN0000078666 CCTGATGTTCTTTGGATTCAA pLKO.1 327 5UTR 100% 5.625 3.938 N GK5 n/a
7 TRCN0000359787 ATGACTTCAGACCTGATTAAT pLKO_005 1411 CDS 100% 15.000 9.000 N GK5 n/a
8 TRCN0000370732 TTGATACCTGGTTGTTATATA pLKO_005 724 5UTR 100% 15.000 9.000 N GK5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006090.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.