Transcript: Human XM_017006137.2

PREDICTED: Homo sapiens sushi domain containing 5 (SUSD5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUSD5 (26032)
Length:
4988
CDS:
728..2287

Additional Resources:

NCBI RefSeq record:
XM_017006137.2
NBCI Gene record:
SUSD5 (26032)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245939 AGACAACCACAGTGGTGTAAA pLKO_005 1360 CDS 100% 13.200 10.560 N SUSD5 n/a
2 TRCN0000245940 CTGAGGCACACATTGACTATG pLKO_005 1002 CDS 100% 10.800 8.640 N SUSD5 n/a
3 TRCN0000245938 AGCTCCACCCTGGAGATATTA pLKO_005 1871 CDS 100% 15.000 10.500 N SUSD5 n/a
4 TRCN0000245937 TACCAACAAATAGGCAATATT pLKO_005 4624 3UTR 100% 0.000 0.000 N SUSD5 n/a
5 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2814 3UTR 100% 4.950 2.475 Y LOC387873 n/a
6 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 2778 3UTR 100% 4.950 2.475 Y LOC400464 n/a
7 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2848 3UTR 100% 10.800 5.400 Y MRPS16 n/a
8 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2848 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006137.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.