Transcript: Human XM_017006144.1

PREDICTED: Homo sapiens ELKS/RAB6-interacting/CAST family member 2 (ERC2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ERC2 (26059)
Length:
6424
CDS:
270..3203

Additional Resources:

NCBI RefSeq record:
XM_017006144.1
NBCI Gene record:
ERC2 (26059)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149965 CGCGAAGAAGAGATCAAACAA pLKO.1 1536 CDS 100% 5.625 7.875 N ERC2 n/a
2 TRCN0000149225 GCCCGAGATGAGTCAATTAAA pLKO.1 1191 CDS 100% 15.000 12.000 N ERC2 n/a
3 TRCN0000147349 GCCTTACAAACAAAGCTTGAA pLKO.1 1647 CDS 100% 4.950 3.960 N ERC2 n/a
4 TRCN0000147850 GTCCTTTCATACACAGATCAA pLKO.1 609 CDS 100% 4.950 3.960 N ERC2 n/a
5 TRCN0000148878 CCTCGTTTGATAGTGCTTCTT pLKO.1 6141 3UTR 100% 4.950 3.465 N ERC2 n/a
6 TRCN0000149866 GCTTGAAAGAACAGCGAGAAA pLKO.1 2089 CDS 100% 4.950 3.465 N ERC2 n/a
7 TRCN0000148165 GCTTTGTTCTTGTCATCAGTA pLKO.1 5146 3UTR 100% 4.950 3.465 N ERC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006144.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.