Transcript: Human XM_017006190.1

PREDICTED: Homo sapiens golgin B1 (GOLGB1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GOLGB1 (2804)
Length:
11839
CDS:
769..10560

Additional Resources:

NCBI RefSeq record:
XM_017006190.1
NBCI Gene record:
GOLGB1 (2804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147838 GCAGGACAAATAAGTAAGGAA pLKO.1 3670 CDS 100% 3.000 2.400 N GOLGB1 n/a
2 TRCN0000146702 CCTCACAACTAGAAGATTCTT pLKO.1 9227 CDS 100% 5.625 3.938 N GOLGB1 n/a
3 TRCN0000147752 GCAGACAATCTCAAGTTGAAA pLKO.1 7051 CDS 100% 5.625 3.938 N GOLGB1 n/a
4 TRCN0000147531 GCAGGGATAATGAGAAATGAA pLKO.1 8836 CDS 100% 5.625 3.938 N GOLGB1 n/a
5 TRCN0000148716 CCGTAGCACTTGTAAAGGAAA pLKO.1 4175 CDS 100% 4.950 3.465 N GOLGB1 n/a
6 TRCN0000147839 GAAGGTACTTTAGGACTCTAT pLKO.1 8635 CDS 100% 4.950 3.465 N GOLGB1 n/a
7 TRCN0000147837 GCACTGAACATCAAAGTAGAA pLKO.1 2687 CDS 100% 4.950 3.465 N GOLGB1 n/a
8 TRCN0000147571 GCTTCTGCTTAATCTGAGAAT pLKO.1 10777 3UTR 100% 4.950 3.465 N GOLGB1 n/a
9 TRCN0000148998 GTCTTCCCATTTACAGGTCTT pLKO.1 10646 3UTR 100% 4.050 2.430 N GOLGB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006190.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.