Transcript: Human XM_017006252.2

PREDICTED: Homo sapiens sulfatase modifying factor 1 (SUMF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUMF1 (285362)
Length:
2754
CDS:
25..1311

Additional Resources:

NCBI RefSeq record:
XM_017006252.2
NBCI Gene record:
SUMF1 (285362)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000131179 GAGAAGTTTGGCGACTCCTTT pLKO.1 472 CDS 100% 4.950 6.930 N SUMF1 n/a
2 TRCN0000118698 CCTCCCAATGGTTATGGCTTA pLKO.1 877 CDS 100% 4.050 5.670 N SUMF1 n/a
3 TRCN0000129888 GAGCAAGTGAAGACCAATATT pLKO.1 514 CDS 100% 15.000 10.500 N SUMF1 n/a
4 TRCN0000118701 TGTGAACTCAACTGGCTATTT pLKO.1 441 CDS 100% 13.200 9.240 N SUMF1 n/a
5 TRCN0000130722 GCGAGGAGAGTTACTATTGAT pLKO.1 370 CDS 100% 5.625 3.938 N SUMF1 n/a
6 TRCN0000129448 GCATGTTGAGTGAGCAAGTGA pLKO.1 503 CDS 100% 3.000 2.100 N SUMF1 n/a
7 TRCN0000130918 GATCCTCAGATAAAGCAGGAT pLKO.1 337 CDS 100% 0.264 0.185 N SUMF1 n/a
8 TRCN0000118700 GATGCCTATGAAGTCAGTAAT pLKO.1 403 CDS 100% 13.200 7.920 N SUMF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006252.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.