Transcript: Human XM_017006253.1

PREDICTED: Homo sapiens sulfatase modifying factor 1 (SUMF1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUMF1 (285362)
Length:
3040
CDS:
26..1297

Additional Resources:

NCBI RefSeq record:
XM_017006253.1
NBCI Gene record:
SUMF1 (285362)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017006253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118698 CCTCCCAATGGTTATGGCTTA pLKO.1 803 CDS 100% 4.050 5.670 N SUMF1 n/a
2 TRCN0000118701 TGTGAACTCAACTGGCTATTT pLKO.1 442 CDS 100% 13.200 9.240 N SUMF1 n/a
3 TRCN0000130722 GCGAGGAGAGTTACTATTGAT pLKO.1 371 CDS 100% 5.625 3.938 N SUMF1 n/a
4 TRCN0000130918 GATCCTCAGATAAAGCAGGAT pLKO.1 338 CDS 100% 0.264 0.185 N SUMF1 n/a
5 TRCN0000118700 GATGCCTATGAAGTCAGTAAT pLKO.1 404 CDS 100% 13.200 7.920 N SUMF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017006253.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.